The standard barcoding fragment for the Barcoding of Life initiative is a ~ 640 bp long fragment located at the 5' site of the mitochondrial cytochrome oxidase subunit 1 (CO1).
The COI sequences of tardigrades have been shown to be useful in solving phylogenetic analysis at low taxonomic level in tardigrades.

However, we also strongly suggest sequencing the internal transcribed spacer 2 (ITS2) region, which exhibits a higher substitution rate, and the compensatory base changes (CBC) can be used excellent for distinguishing tardigrade species and the 18S rDNA as a good conservative taxonomic sequence.

Standard barcoding primer (Folmer et al., 1994):
LCO1490: GGTCAACAAATCATAAAGATATTGG
HCO2198: TAAACTTCAGGGTGACCAAAAAATCA



Universal primers ITS3 and ITS4 (White et al., 1990)
ITS3: 5’-GCATCGATGAAGAACGCAGC-3’
ITS4: 5’-TCCTCCGCTTATTGATATGC-3’

Universal primers small subunit nuclear ribosomal RNA
(SSU rRNA) (Medlin et al., 1988)
18S: 5’-aacctggttgatcctgccagt-3’
18S: 5’-tgatccttctgcaggttcacctac-3’

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology & Biotechnology 3, 294-299.

Guidetti, R., Gandolfi, A., Rossi, V. and Bertolani, R. (2005). Phylogenetic analysis of macrobiotidae (eutardigrada, parachela): a combined morphological and molecular approach. Zoologica Scripta 34, 235-244.

Guidetti, R., Schill, R. O., Bertolani, R., Dandekar, T. and Wolf, M. (2009). New molecular data for tardigrade phylogeny, with the erection of Paramacrobiotus gen. nov. Journal of Zoological Systematics and Evolutionary Research, 47(4), 315–321.

Jørgensen, A. and Kristensen, R. M. (2004). Molecular phylogeny of tardigrada - investigation of the monophyly of heterotardigrada. Molecular Phylogenetics and Evolution, 32 (2), 666-670.

Jørgensen, A., Møbjerg, N. and Kristensen, R. M. (2007). A molecular study of the tardigrade Echiniscus testudo (Echiniscidae) reveals low DNA sequence diversity over a large geographical area. Journal of Limnology 66, 77-83.

Sands, C. J., Convey, P., Linse, K. and McInnes, S. J. (2008a). Assessing meiofaunal variation among individuals utilising morphological and molecular approaches: an example using the Tardigrada. BMC Ecology 8, 7.

Sands, C. J., McInnes, S. J., Marley, N. J., Goodall-Copestakea, W. P., Conveya, P. and Linse, K. (2008b). Phylum Tardigrada: an ‘‘individual’’ approach. Cladistics 24, 1-11.

Schill, R. O., Förster, F., Dandekar, T. and Wolf, M. (submitted). Distinguishing species in Paramacrobiotus (Tardigrada) via compensatory base change analysis of internal transcribed spacer
2 secondary structures, with the description of four new species.

White, T.J., Bruns, T., Lee, S., Taylor, J. (1990). PCR protocols: a guide to methods and application, chap. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics, pp. 315–322. Academic Press, Inc., San Diego, California.

Medlin, L, Elwood, H. J., Stickel, S. and Sogin, M.L. (1988). The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 71, 491–499.